Stem-loop sequence ssc-mir-10b

AccessionMI0013102 (change log)
DescriptionSus scrofa miR-10b stem-loop
Gene family MIPF0000033; mir-10
Literature search

28 open access papers mention ssc-mir-10b
(84 sentences)

Stem-loop
   -- u        a    g     c          -ug  au 
5'   g cuauauau cccu uagaa cgaauuugug   gu  c
     | |||||||| |||| ||||| ||||||||||   ||   
3'   c gguauaua gggg aucuu gcuuagacac   ua  c
   ag u        a    -     a          uga  ca 
Get sequence
Deep sequencing
122657 reads, 4.96e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr15: 91419021-91419100 [+]
sense
ENSSSCT00000021537 ; ssc-mir-10b.1-201; exon 1
Database links

Mature sequence ssc-miR-10b

Accession MIMAT0013885
Sequence

10 - 

uacccuguagaaccgaauuugu

 - 31

Get sequence
Deep sequencing118280 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).