Stem-loop sequence ssc-mir-10a

AccessionMI0013101 (change log)
DescriptionSus scrofa miR-10a stem-loop
Gene family MIPF0000033; mir-10
Literature search

19 open access papers mention ssc-mir-10a
(58 sentences)

Stem-loop
   ---u        a    g     c          uaaggaa 
5'     cuguauau cccu uagau cgaauuugug       u
       |||||||| |||| ||||| ||||||||||        
3'     gauguaua gggg aucua gcuuaaacac       u
   aguu        a    -     u          ugguguu 
Get sequence
Deep sequencing
7074 reads, 2.04e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 24791267-24791346 [-]
sense
ENSSSCT00000020865 ; ssc-mir-10a.1-201; exon 1
Database links

Mature sequence ssc-miR-10a-5p

Accession MIMAT0013884
Previous IDsssc-miR-10a
Sequence

9 - 

uacccuguagauccgaauuugu

 - 30

Get sequence
Deep sequencing7060 reads, 15 experiments
Evidence experimental; Illumina [1-3]

Mature sequence ssc-miR-10a-3p

Accession MIMAT0022954
Sequence

50 - 

caaauucguaucuaggggaau

 - 70

Get sequence
Deep sequencing12 reads, 8 experiments
Evidence experimental; Illumina [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).