Stem-loop sequence ssc-mir-151

AccessionMI0013100 (change log)
DescriptionSus scrofa miR-151 stem-loop
Gene family MIPF0000057; mir-28
Literature search

4 open access papers mention ssc-mir-151
(4 sentences)

Stem-loop
   ---uu      c            ca          c ucu 
5'      uuccug ccucgaggagcu  cagucuagua g   c
        |||||| ||||||||||||  |||||||||| |    
3'      agggac ggaguuccucga  gucagaucau c   a
   cugcu      a            -a          c ccu 
Get sequence
Deep sequencing
8674 reads, 913 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf1855: 7087-7166 [+]
intergenic
Database links

Mature sequence ssc-miR-151-5p

Accession MIMAT0013882
Sequence

12 - 

ucgaggagcucacagucuagu

 - 32

Get sequence
Deep sequencing4572 reads, 15 experiments
Evidence experimental; Illumina [1,3], cloned [2]

Mature sequence ssc-miR-151-3p

Accession MIMAT0013883
Sequence

48 - 

cuagacugaagcuccuugagga

 - 69

Get sequence
Deep sequencing4102 reads, 15 experiments
Evidence experimental; Illumina [1,3], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).