Stem-loop sequence ssc-mir-423

AccessionMI0013099 (change log)
DescriptionSus scrofa miR-423 stem-loop
Gene family MIPF0000329; mir-423
Literature search

12 open access papers mention ssc-mir-423
(21 sentences)

Stem-loop
   -----    u            -ag   g    a     cua 
5'      aagu aggcugaggggc   aga cgag cuuuu   u
        |||| ||||||||||||   ||| |||| |||||   u
3'      uucg ucugacuccccg   ucu gcuc gaaaa   u
   caucc    u            gag   g    -     ccu 
Get sequence
Deep sequencing
5361 reads, 553 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 48287019-48287098 [-]
sense
ENSSSCT00000019367 ; NSRP1-201; intron 1
Database links

Mature sequence ssc-miR-423-5p

Accession MIMAT0013880
Sequence

10 - 

ugaggggcagagagcgagacuuu

 - 32

Get sequence
Deep sequencing3496 reads, 15 experiments
Evidence experimental; Illumina [1-3]

Mature sequence ssc-miR-423-3p

Accession MIMAT0013881
Sequence

46 - 

agcucggucugaggccccucagu

 - 68

Get sequence
Deep sequencing1865 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).