Stem-loop sequence ssc-mir-143

AccessionMI0013098 (change log)
DescriptionSus scrofa miR-143 stem-loop
Gene family MIPF0000094; mir-143
Literature search

31 open access papers mention ssc-mir-143
(110 sentences)

Stem-loop
   g  c   ag  g   g         g      u  -  ag 
5'  uc ccc  cc gag ugcagugcu caucuc gg uc  c
    || |||  || ||| ||||||||| |||||| || ||   
3'  ag ggg  gg cuc augucacga guagag cu ag  u
   -  a   aa  g   g         a      u  g  gg 
Get sequence
Deep sequencing
670531 reads, 1.62e+05 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 157344738-157344817 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-143
ssc-mir-143chr2: 157344738-157344817 [+]
ssc-mir-145chr2: 157346127-157346212 [+]
Database links

Mature sequence ssc-miR-143-5p

Accession MIMAT0017374
Sequence

15 - 

ggugcagugcugcaucucugg

 - 35

Get sequence
Deep sequencing1685 reads, 15 experiments
Evidence experimental; Illumina [2,4-5]

Mature sequence ssc-miR-143-3p

Accession MIMAT0013879
Previous IDsssc-miR-143
Sequence

49 - 

ugagaugaagcacuguagcuc

 - 69

Get sequence
Deep sequencing668836 reads, 15 experiments
Evidence experimental; Illumina [1-2,4-5], cloned [3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).