Stem-loop sequence ssc-mir-320

AccessionMI0013097 (change log)
DescriptionSus scrofa miR-320 stem-loop
Gene family MIPF0000163; mir-320
Literature search

9 open access papers mention ssc-mir-320
(22 sentences)

Stem-loop
   gc       ---------         uu       c      g 
5'   uccccuc         cgccuucuc  cccgguu uucccg a
     |||||||         |||||||||  ||||||| ||||||  
3'   aggggag         gcgggagag  gggucga aagggc g
   -c       aaggaaaaa         uu       a      u 
Get sequence
Deep sequencing
6549 reads, 780 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr14: 6954934-6955013 [-]
antisense
ENSSSCT00000010548 ; POLR3D-201; 3'UTR (exon 1)
Database links

Mature sequence ssc-miR-320

Accession MIMAT0013878
Sequence

43 - 

aaaagcuggguugagagggcgaa

 - 65

Get sequence
Deep sequencing6542 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).