Stem-loop sequence ssc-mir-199a-2

AccessionMI0013093 (change log)
Previous IDsssc-mir-199a
DescriptionSus scrofa miR-199a-2 stem-loop
Gene family MIPF0000040; mir-199
Literature search

18 open access papers mention ssc-mir-199a-2
(102 sentences)

Stem-loop
   -   c   aac       u        c   ------     g 
5'  ccc gcc   ccagugu cagacuac ugu      ucagg g
    ||| |||   ||||||| |||||||| |||      |||||  
3'  ggg cgg   gguuaca gucugaug aca      agucu g
   c   u   auu       c        -   ugugua     c 
Get sequence
Deep sequencing
46991 reads, 8.43e+03 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 69991779-69991858 [-]
antisense
ENSSSCT00000014885 ; DNM2-201; intron 13
Database links

Mature sequence ssc-miR-199a-5p

Accession MIMAT0013874
Sequence

10 - 

cccaguguucagacuaccuguuc

 - 32

Get sequence
Deep sequencing28303 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2-3]

Mature sequence ssc-miR-199a-3p

Accession MIMAT0013875
Sequence

51 - 

acaguagucugcacauugguua

 - 72

Get sequence
Deep sequencing68359 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2-4]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).