Stem-loop sequence ssc-mir-30e

AccessionMI0013092 (change log)
DescriptionSus scrofa miR-30e stem-loop
Gene family MIPF0000005; mir-30
Literature search

21 open access papers mention ssc-mir-30e
(60 sentences)

Stem-loop
   --u     a            uu           g ga  c 
5'    uugcc cuguaaacaucc  gacuggaagcu u  gg g
      ||||| ||||||||||||  ||||||||||| |  ||  
3'    gacgg gacauuuguagg  cugacuuucga g  cc u
   ucg     c            --           g ac  u 
Get sequence
Deep sequencing
57763 reads, 1.08e+04 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 157476655-157476734 [-]
sense
ENSSSCT00000004398 ; NFYC-201; intron 4
Clustered miRNAs
< 10kb from ssc-mir-30e
ssc-mir-30echr6: 157476655-157476734 [-]
ssc-mir-30c-1chr6: 157473595-157473674 [-]
Database links

Mature sequence ssc-miR-30e-5p

Accession MIMAT0013872
Sequence

9 - 

uguaaacauccuugacuggaagcu

 - 32

Get sequence
Deep sequencing56165 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

Mature sequence ssc-miR-30e-3p

Accession MIMAT0013873
Sequence

51 - 

cuuucagucggauguuuacagc

 - 72

Get sequence
Deep sequencing1597 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).