Stem-loop sequence ssc-mir-30d

AccessionMI0013091 (change log)
DescriptionSus scrofa miR-30d stem-loop
Gene family MIPF0000005; mir-30
Literature search

17 open access papers mention ssc-mir-30d
(32 sentences)

Stem-loop
   -----cu  u  u         ccc           gua  ac 
5'        gu gu guaaacauc   gacuggaagcu   ag  a
          || || |||||||||   |||||||||||   ||   
3'        ca cg cguuuguag   cugacuuucga   uc  u
   ucucagc  c  u         --a           --a  ga 
Get sequence
Deep sequencing
39165 reads, 7.07e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr4: 6713518-6713596 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-30d
ssc-mir-30dchr4: 6713518-6713596 [+]
ssc-mir-30bchr4: 6717643-6717718 [+]
Database links

Mature sequence ssc-miR-30d

Accession MIMAT0013871
Sequence

8 - 

uguaaacauccccgacuggaagcu

 - 31

Get sequence
Deep sequencing39072 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).