Stem-loop sequence ssc-mir-29a

AccessionMI0013090 (change log)
DescriptionSus scrofa miR-29a stem-loop
Gene family MIPF0000009; mir-29
Literature search

32 open access papers mention ssc-mir-29a
(93 sentences)

Stem-loop
       uuagagg            uuu       c    ucaa 
5' cccc       augacugauuuc   ugguguu agag    u
   ||||       ||||||||||||   ||||||| ||||    a
3' gggg       uauuggcuaaag   accacga ucuu    u
       uuaguaa            ucu       -    uuaa 
Get sequence
Deep sequencing
7202 reads, 1.16e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr18: 19035225-19035310 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-29a
ssc-mir-29b-1chr18: 19034822-19034902 [+]
ssc-mir-29achr18: 19035225-19035310 [+]
Database links

Mature sequence ssc-miR-29a-5p

Accession MIMAT0037364
Sequence

15 - 

acugauuucuuuugguguucag

 - 36

Get sequence
Deep sequencing20 reads, 8 experiments
Evidence experimental; Illumina [5], 454 [6]

Mature sequence ssc-miR-29a-3p

Accession MIMAT0013870
Sequence

52 - 

cuagcaccaucugaaaucgguua

 - 74

Get sequence
Deep sequencing7182 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).
5
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).
6
PMID:25934266 "Evaluation of the capability of the PCV2 genome to encode miRNAs: lack of viral miRNA expression in an experimental infection" Nunez-Hernandez F, Perez LJ, Vera G, Cordoba S, Segales J, Sanchez A, Nunez JI Vet Res. 46:48(2015).