Stem-loop sequence ssc-mir-133b

AccessionMI0013089 (change log)
DescriptionSus scrofa miR-133b stem-loop
Gene family MIPF0000029; mir-133
Literature search

31 open access papers mention ssc-mir-133b
(152 sentences)

Stem-loop
   -----      c        ca  c  a      u  g      
5'      ccugcu uggcuggu  aa gg accaag cc ucuuc 
        |||||| ||||||||  || || |||||| || |||| c
3'      ggacga aucgacca  uu cc ugguuu gg agagu 
   ggucg      u        ac  c  c      -  -      
Get sequence
Deep sequencing
1229 reads, 273 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr7: 52430290-52430369 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-133b
ssc-mir-206chr7: 52426445-52426524 [+]
ssc-mir-133bchr7: 52430290-52430369 [+]
Database links

Mature sequence ssc-miR-133b

Accession MIMAT0013869
Sequence

47 - 

uuugguccccuucaaccagcuau

 - 69

Get sequence
Deep sequencing1229 reads, 11 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).