Stem-loop sequence ssc-mir-378-1

AccessionMI0013088 (change log)
Previous IDsssc-mir-378
DescriptionSus scrofa miR-378-1 stem-loop
Gene family MIPF0000168; mir-378
Literature search

20 open access papers mention ssc-mir-378-1
(98 sentences)

Stem-loop
   --    c    g  c              ugu      ccu 
5'   ccac cagg cu cugacuccaggucc   guguug   g
     |||| |||| || ||||||||||||||   ||||||    
3'   ggug gucc ga gacugagguucagg   cacgau   g
   ga    c    g  a              --u      aaa 
Get sequence
Deep sequencing
841 reads, 13.3 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 157640353-157640432 [+]
intergenic
Database links

Mature sequence ssc-miR-378

Accession MIMAT0013868
Sequence

49 - 

acuggacuuggagucagaaggc

 - 70

Get sequence
Deep sequencing1823 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).