Stem-loop sequence ssc-let-7g

AccessionMI0013087 (change log)
DescriptionSus scrofa let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

41 open access papers mention ssc-let-7g
(122 sentences)

Stem-loop
   ggcu        a            ugagg    -a  a    a 
5'     gagguagu guuuguacaguu     gucu  ug uacc c
       |||||||| ||||||||||||     ||||  || ||||  
3'     uuccguca cggacaugucaa     uaga  ac augg c
   ---g        c            -----    gg  -    c 
Get sequence
Deep sequencing
160252 reads, 4.71e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr13: 37599004-37599083 [+]
sense
ENSSSCT00000020901 ; ssc-let-7g.1-201; exon 1
ENSSSCT00000012513 ; WDR82-201; intron 2
Database links

Mature sequence ssc-let-7g

Accession MIMAT0013867
Sequence

4 - 

ugagguaguaguuuguacaguu

 - 25

Get sequence
Deep sequencing160252 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).