Stem-loop sequence ssc-let-7e

AccessionMI0013086 (change log)
DescriptionSus scrofa let-7e stem-loop
Gene family MIPF0000002; let-7
Literature search

40 open access papers mention ssc-let-7e
(138 sentences)

Stem-loop
   gcccc   cu   g                u  ----g a  a 
5'      ggg  gag uaggagguuguauagu ga     g gg c
        |||  ||| |||||||||||||||| ||     | ||  
3'      ccc  uuc auccuccggcauauca cu     c cc a
   ---ga   cu   g                -  agagg a  c 
Get sequence
Deep sequencing
12991 reads, 2.57e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 51858376-51858455 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-let-7e
ssc-mir-99bchr6: 51858217-51858286 [+]
ssc-let-7echr6: 51858376-51858455 [+]
ssc-mir-125achr6: 51858852-51858931 [+]
Database links

Mature sequence ssc-let-7e

Accession MIMAT0013866
Sequence

10 - 

ugagguaggagguuguauaguu

 - 31

Get sequence
Deep sequencing12951 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).