Stem-loop sequence ssc-let-7a-1

AccessionMI0013085 (change log)
Previous IDsssc-let-7a
DescriptionSus scrofa let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

50 open access papers mention ssc-let-7a-1
(151 sentences)

Stem-loop
   -      uu   g   u            uuagaauug    aa 
5'  cccagg  gag uag agguuguauagu         uauc  g
    ||||||  ||| ||| ||||||||||||         ||||   
3'  ggguuc  uuc auc uccgacauguca         auag  g
   u      cu   g   c            ---------    ag 
Get sequence
Deep sequencing
87035 reads, 2.63e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 54378059-54378138 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-let-7a-1
ssc-mir-100chr9: 54383382-54383461 [-]
ssc-let-7a-1chr9: 54378059-54378138 [-]
Database links

Mature sequence ssc-let-7a

Accession MIMAT0013865
Sequence

8 - 

ugagguaguagguuguauaguu

 - 29

Get sequence
Deep sequencing151662 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).