Stem-loop sequence ssc-mir-206

AccessionMI0013084 (change log)
DescriptionSus scrofa miR-206 stem-loop
Gene family MIPF0000038; mir-1
Literature search

30 open access papers mention ssc-mir-206
(191 sentences)

Stem-loop
   uucc    gc                 cc     c gauu 
5'     cgag  cacaugcuucuuuauau  ccaua g    a
       ||||  |||||||||||||||||  ||||| |     
3'     gcuc  gugugugaaggaaugua  gguau c    c
   aauu    ua                 -a     - aguu 
Get sequence
Deep sequencing
94 reads, 6.67 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr7: 52426445-52426524 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-206
ssc-mir-206chr7: 52426445-52426524 [+]
ssc-mir-133bchr7: 52430290-52430369 [+]
Database links

Mature sequence ssc-miR-206

Accession MIMAT0013864
Sequence

50 - 

uggaauguaaggaaguguguga

 - 71

Get sequence
Deep sequencing93 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).