|
miRBase |
|
Stem-loop sequence hsa-mir-2909 |
|||||
| Accession | MI0013083 | ||||
| Description | Homo sapiens miR-2909 stem-loop | ||||
| Stem-loop |
-- -gc - - ucuuu c gguguuagg caaca uc ucuugg cc c ||||||||| ||||| || |||||| || u ccgcaauuc guugu gg agaacc gg g ua aac c u ---cu u |
||||
| Deep sequencing |
| ||||
| Comments |
This miRNA was referred to as hmiR-che-1 in [1]. |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-2909 |
|
| Accession | MIMAT0013863 |
| Sequence |
4 - guuagggccaacaucucuugg - 24 |
| Evidence | experimental; qPCR [1] |
| Predicted targets |
|
References |
|
| 1 |
"Cellular AATF gene encodes a novel miRNA that can contribute to HIV-1 latency"
Indian J. Biochem. Biophys. 46:237-240(2009).
|