Stem-loop sequence bta-mir-378-2

AccessionMI0013052 (change log)
DescriptionBos taurus miR-378-2 stem-loop
Gene family MIPF0000168; mir-378
Literature search

24 open access papers mention bta-mir-378-2
(100 sentences)

Stem-loop
   ------------------------------------gga    a ug a   gga 
5'                                        gagc c  g cuu   g
                                          |||| |  | |||    
3'                                        uucg g  c gaa   u
   ccgcaucaagagguggucaucuacugccacgacgggaca    a gu g   gac 
Get sequence
Deep sequencing
827234 reads, 6.48e+03 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 10779742-10779817 [+]
antisense
ENSBTAT00000023201 ; CALCR-201; intron 2
Database links

Mature sequence bta-miR-378

Accession MIMAT0009305
Sequence

8 - 

acuggacuuggagucagaaggc

 - 29

Get sequence
Deep sequencing1654631 reads, 78 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).