Stem-loop sequence osa-MIR1863b

AccessionMI0013050 (change log)
DescriptionOryza sativa miR1863b stem-loop
Gene family MIPF0000932; MIR1863
Literature search

3 open access papers mention osa-MIR1863b
(6 sentences)

Stem-loop
   -----   u  c             c     c  c       -                 -------a     a    aaugaau  uuau       caauccccugcugcuaggagcuguagcucucggggcaguaccuaauccgcugcugaucuguuucuagucaugaaaagcacugugaucug 
5'      caa ag aaugcaucaguua guuuc ua auaguua caugguaucagagcuga        auccu aacc       gu    ccagcac                                                                                         u
        ||| || ||||||||||||| ||||| || ||||||| |||||||||||||||||        ||||| ||||       ||    |||||||                                                                                         a
3'      guu uc uuacguagucggu cagag au ugucaau guaccauagucucgauu        uagga uugg       ca    gguugug                                                                                         a
   caaag   u  a             u     -  u       u                 gucgauuc     g    ---gguu  ucuc       uuuagguagugacuaauaacguagugacaguccagugcuuagguugcuaccgguaucuuaacccguuuugguaccguacgucguucgug 
Get sequence
Deep sequencing
584 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 4867257-4867616 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1863b
osa-MIR1863bChr12: 4867257-4867616 [+]
osa-MIR1863cChr12: 4869207-4869497 [+]
Database links

Mature sequence osa-miR1863b

Accession MIMAT0013836
Sequence

304 - 

agcucugauaccauguuaacuguu

 - 327

Get sequence
Deep sequencing433 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence osa-miR1863b.2

Accession MIMAT0020950
Sequence

329 - 

agagacuuggcugaugcauuacu

 - 351

Get sequence
Deep sequencing145 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).
2
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).