Stem-loop sequence osa-MIR396d

AccessionMI0013049 (change log)
DescriptionOryza sativa miR396d stem-loop
Gene family MIPF0000882; MIR396_2
Literature search

55 open access papers mention osa-MIR396d
(138 sentences)

Stem-loop
   --uaca    g g    u       -g         a    --gg  g  gg   -  ug  g 
5'       gcga u guuc ggaaggc  guggaggug cggc    cg cc  cgc cg  gc g
         |||| | |||| |||||||  ||||||||| ||||    || ||  ||| ||  || g
3'       cguu g caag ucuuucg  caccuucgc gucg    gc gg  gug gc  cg g
   cgccgg    - g    u       ga         -    agca  g  gg   a  gu  g 
Get sequence
Deep sequencing
2132 reads, 1.3e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR396d

Accession MIMAT0013835
Sequence

91 - 

uccacaggcuuucuugaacgg

 - 111

Get sequence
Deep sequencing1577 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).