Stem-loop sequence osa-MIR396h

AccessionMI0013048 (change log)
DescriptionOryza sativa miR396h stem-loop
Gene family MIPF0000882; MIR396_2
Stem-loop
   ag   ----    -gg        -g    ug   guggg   g      g  ga g     ---ga   g  g 
5'   ggc    gccg   gaggaggu  gugg  gug     ggc acgccg cg  g uguuc     cgc gc g
     |||    ||||   ||||||||  ||||  |||     ||| |||||| ||  | |||||     ||| ||  
3'   ccg    uggc   uucuuucg  cacc  uac     ccg ugcggc gc  c gcagg     gcg ug a
   ca   uucu    aag        ga    uu   aggaa   g      g  gg g     aggag   g  g 
Get sequence
Deep sequencing
2123 reads, 1.3e+03 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 32841661-32841801 [+]
intergenic
Database links

Mature sequence osa-miR396h

Accession MIMAT0013834
Sequence

111 - 

uccacaggcuuucuugaacgg

 - 131

Get sequence
Deep sequencing2112 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).