Stem-loop sequence osa-MIR396g

AccessionMI0013047 (change log)
DescriptionOryza sativa miR396g stem-loop
Gene family MIPF0000882; MIR396_2
Literature search

53 open access papers mention osa-MIR396g
(131 sentences)

Stem-loop
   --     cguc   g   gg     -   gag      c  ga aggag g   g     g      ----a   g -g     ---------  g     u 
5'   ggcga    gag cgu  aagga guc   guggag ug  g     c ccg cgccg cgccgu     gcu g  cgcgu         cg cgucg g
     |||||    ||| |||  ||||| |||   |||||| ||  |     | ||| ||||| ||||||     ||| |  |||||         || ||||| c
3'   ccguu    cuu gca  uucuu cgg   caccuu ac  c     g ggc gcggc gcggca     cgg c  gcgcg         gc gcggc g
   cg     ----   g   ag     u   --a      u  gg ---gg g   g     g      gaugg   g ag     agagguaga  g     g 
Get sequence
Deep sequencing
2115 reads, 1.3e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 5300630-5300810 [-]
intergenic
Database links

Mature sequence osa-miR396g

Accession MIMAT0013833
Sequence

151 - 

uccacaggcuuucuugaacgg

 - 171

Get sequence
Deep sequencing2112 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).