Stem-loop sequence osa-MIR2879

AccessionMI0013045 (change log)
DescriptionOryza sativa miR2879 stem-loop
Literature search

2 open access papers mention osa-MIR2879
(2 sentences)

Stem-loop
   ugcccag   cg  c           c         c  a    c        --       ua   a  a     g   a     -   a  ugu  a    u  caaucagaucacaaaagauuauacugacacuaaauucaucugaucuagua 
5'        acg  cu uggucauuauu uaacauauc gg ucaa uggagaga  gaauuuu  gaa gg uguuu ugc cuugu uca cc   uu acaa ca                                                  c
          |||  || ||||||||||| ||||||||| || |||| ||||||||  |||||||  ||| || ||||| ||| ||||| ||| ||   || |||| ||                                                   
3'        ugu  ga accaguaauaa auuguguag cc aguu accucucu  uuuaaaa  uuu cc gcgaa aug gagca ggu gg   aa uguu gu                                                  u
   -------   au  u           a         a  g    a        aa       ua   a  -     a   g     c   a  --u  c    u  agauuuuuacuaguucaucaguuuuguucuccguaauacgccuuuuuauu 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 18895908-18896208 [-]
intergenic
Database links

Mature sequence osa-miR2879

Accession MIMAT0013831
Sequence

269 - 

gccagauguguuaaaauaaugacc

 - 292

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).