Stem-loop sequence osa-MIR1863c

AccessionMI0013044 (change log)
DescriptionOryza sativa miR1863c stem-loop
Gene family MIPF0000932; MIR1863
Literature search

3 open access papers mention osa-MIR1863c
(6 sentences)

Stem-loop
   --------------------------------------agcaaugcaucaguuauguuuccuggaucauuaaauca     u  uuau       c    ug        ----------     ugu        aaagcacuuuaugaucugaaagugcuggcuguau 
5'                                                                             uugaa gu    cuagcac aauc  cugcugau          cuguu   agucauga                                  g
                                                                               ||||| ||    ||||||| ||||  ||||||||          |||||   ||||||||                                   
3'                                                                             ggcuu ca    gguugug uuag  gaugacua          gauaa   ucagugcu                                  c
   cagagguuuucauuacguagucgguucaaagauuuaguuauuguaccauagucucgauuauugauacuaggauuug     -  ucuc       c    gu        auaacguagu     --u        aacguuauuauugguaucuuaccccuuuugguac 
Get sequence
Deep sequencing
205 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 4869207-4869497 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1863c
osa-MIR1863bChr12: 4867257-4867616 [+]
osa-MIR1863cChr12: 4869207-4869497 [+]
Database links

Mature sequence osa-miR1863c

Accession MIMAT0013830
Sequence

259 - 

uagaaacuuggcugaugcauuacu

 - 282

Get sequence
Deep sequencing151 reads, 2 experiments
Evidence experimental; Illumina [1-2]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).