Stem-loop sequence osa-MIR2878

AccessionMI0013043 (change log)
DescriptionOryza sativa miR2878 stem-loop
Literature search

3 open access papers mention osa-MIR2878
(18 sentences)

Stem-loop
   -       uuc                                      a 
5'  auaaugu   uuuaguucuuuacauguauaaaauucugaggauguuau u
    |||||||   ||||||||||||||||||||||||||||||||||||||  
3'  uauuaca   aaauuaagaaauguacauauuuuaggacuccuacagua a
   a       uac                                      u 
Get sequence
Deep sequencing
118 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 26181373-26181473 [+]
intergenic
Database links

Mature sequence osa-miR2878-5p

Accession MIMAT0013828
Sequence

21 - 

uacauguauaaaauucugaggaug

 - 44

Get sequence
Deep sequencing103 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence osa-miR2878-3p

Accession MIMAT0013829
Sequence

63 - 

caggauuuuauacauguaaagaau

 - 86

Get sequence
Deep sequencing15 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).