Stem-loop sequence osa-MIR2877

AccessionMI0013042 (change log)
DescriptionOryza sativa miR2877 stem-loop
Literature search

2 open access papers mention osa-MIR2877
(2 sentences)

Stem-loop
   ------------aaucuugguuuaauguaucauccgauguccaaagugcagaugacgcagcuugggugcugauguggcaa         gu                -   c c  au    c         uc     u     c     u        --uuuug      gg    aacuaugaauuu  u 
5'                                                                                 uccacggug  gagaauuuugcauuua gcc c uc  gcua aguaugccu  aaguc acucc accac cccaaauc       gugcau  cuua            gc g
                                                                                   |||||||||  |||||||||||||||| ||| | ||  |||| |||||||||  ||||| ||||| ||||| ||||||||       ||||||  ||||            || g
3'                                                                                 aggugucac  cucuuaaaacgugaau cgg g ag  ugau ucauacggg  uuuag ugagg uggug ggguuuag       uacgua  gagu            cg a
   aaagggagauuuuuugugggaauuagaaccaaauuacauagugagcuccggguuucacgucuccuacguugaguccgaac         ug                g   a a  --    a         gc     c     a     -        uuguuua      aa    ------------  u 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 28585208-28585568 [-]
intergenic
Database links

Mature sequence osa-miR2877

Accession MIMAT0013827
Sequence

292 - 

uugcauccucugcacuuugggccu

 - 315

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).