Stem-loop sequence osa-MIR2875

AccessionMI0013040 (change log)
DescriptionOryza sativa miR2875 stem-loop
Literature search

1 open access papers mention osa-MIR2875
(2 sentences)

Stem-loop
   --------u                    g            a 
5'          gaucaaauauaugaacugua augacuguaaau u
            |||||||||||||||||||| |||||||||||| a
3'          cuaguuuauauauuugacau uacugacauuua c
   auguuugug                    a            a 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 27092061-27092141 [+]
intergenic
Database links

Mature sequence osa-miR2875

Accession MIMAT0013825
Sequence

40 - 

auuuacagucauauacaguuuaua

 - 63

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).