Stem-loop sequence osa-MIR2873a

AccessionMI0013038 (change log)
Previous IDsosa-MIR2873
DescriptionOryza sativa miR2873 stem-loop
Gene family MIPF0001679; MIR2873
Literature search

2 open access papers mention osa-MIR2873a
(2 sentences)

Stem-loop
   aauauauuc           c           c           u     uu 
5'          uuaccaaauuu aaguucaaacu aacuuuauuug gagaa  u
            ||||||||||| ||||||||||| ||||||||||| |||||  u
3'          aaugguuuaaa uucagguuuga uugaaguaaac cucuu  u
   -----uaac           -           a           u     ug 
Get sequence
Deep sequencing
126 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 28933582-28933682 [-]
intergenic
Database links

Mature sequence osa-miR2873a

Accession MIMAT0013823
Previous IDsosa-miR2873
Sequence

75 - 

aaguuuggacuuaaauuugguaac

 - 98

Get sequence
Deep sequencing118 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).