Stem-loop sequence osa-MIR2872

AccessionMI0013037 (change log)
DescriptionOryza sativa miR2872 stem-loop
Literature search

2 open access papers mention osa-MIR2872
(2 sentences)

Stem-loop
   cuuaga     uca                 ua   u        u  ugauu     c             auggcaacaggaugcucgaucuuccaucagguaaagauaacucuugauuuggcgaaaacuugucacacaugauuugacuuucgaucaacacgaucuaaacuugcaauuucag 
5'       uuauu   uaguucgguuuguagaa  cca cuucgagu cu     aauca ucaucugcaauug                                                                                                                c
         |||||   |||||||||||||||||  ||| |||||||| ||     ||||| |||||||||||||                                                                                                                 
3'       agugg   aucaagccaaacaucuu  ggu gaagcuca ga     uuagu aguagacguuaac                                                                                                                a
   -----a     -ug                 gg   u        c  ----u     a             ucgauguuagauggaaaaagaacgaacauaagaagcuaagcguacguuccuaaucggaagagucacuuccgguuagucuaaagccgugccaaccauugaucuuuucuguacc 
Get sequence
Deep sequencing
37 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 2524994-2525353 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2872
osa-MIR1862eChr11: 2523232-2523324 [+]
osa-MIR2872Chr11: 2524994-2525353 [+]
Database links

Mature sequence osa-miR2872

Accession MIMAT0013822
Sequence

331 - 

ugggguucuacaaaccgaacu

 - 351

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).