Stem-loop sequence osa-MIR2871a

Accession

MI0013035 (change log)

Description

Oryza sativa miR2871a stem-loop

Gene family

MIPF0000986; MIR2871

Literature search

2 open access papers mention osa-MIR2871a
(3 sentences)

Stem-loop

   -----  u                  c        aa    --------a        -    cuuu 
5'      ca ggugaccguagaaacuag auagaaaa  guag         uaucucaa guga    g
        || |||||||||||||||||| ||||||||  ||||         |||||||| ||||     
3'      gu ucacugguaucuuugauu uaucuuuu  cauc         auaggguu cauu    u
   cggug  u                  u        -c    aaugaacag        g    uacu 

Deep sequencing

93 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr5: 3877013-3877133 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0013035

Mature sequence osa-miR2871a-5p

• Accession: MIMAT0020948
• Sequence: 7 - gaccguagaaacuagcauagaaaa - 30
• Deep sequencing: 71 reads, 2 experiments
• Evidence: experimental; Illumina [2-4]
• Database links:
  • RNAcentral:URS0000243D6E_39947

Mature sequence osa-miR2871a-3p

• Accession: MIMAT0013820
• Previous IDs: osa-miR2871a
• Sequence: 92 - uauuuuaguuucuauggucac - 112
• Deep sequencing: 21 reads, 2 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS000004B9C5_39947

References

1. PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).
2. PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).
3. PMID:21791435 "Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)" Peng T, Lv Q, Zhang J, Li J, Du Y, Zhao Q J Exp Bot. 62:4943-4954(2011).
4. PMID:21679406 "Deep sequencing on genome-wide scale reveals the unique composition and expression patterns of microRNAs in developing pollen of Oryza sativa" Wei LQ, Yan LF, Wang T Genome Biol. 12:R53(2011).