Stem-loop sequence osa-MIR2871a

AccessionMI0013035 (change log)
DescriptionOryza sativa miR2871a stem-loop
Gene family MIPF0000986; MIR2871
Literature search

2 open access papers mention osa-MIR2871a
(3 sentences)

Stem-loop
   -----  u                  c        aa    --------a        -    cuuu 
5'      ca ggugaccguagaaacuag auagaaaa  guag         uaucucaa guga    g
        || |||||||||||||||||| ||||||||  ||||         |||||||| ||||     
3'      gu ucacugguaucuuugauu uaucuuuu  cauc         auaggguu cauu    u
   cggug  u                  u        -c    aaugaacag        g    uacu 
Get sequence
Deep sequencing
93 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 3877013-3877133 [+]
intergenic
Database links

Mature sequence osa-miR2871a-5p

Accession MIMAT0020948
Sequence

7 - 

gaccguagaaacuagcauagaaaa

 - 30

Get sequence
Deep sequencing71 reads, 2 experiments
Evidence experimental; Illumina [2-4]
Database links

Mature sequence osa-miR2871a-3p

Accession MIMAT0013820
Previous IDsosa-miR2871a
Sequence

92 - 

uauuuuaguuucuauggucac

 - 112

Get sequence
Deep sequencing21 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).
2
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).
3
PMID:21791435 "Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)" Peng T, Lv Q, Zhang J, Li J, Du Y, Zhao Q J Exp Bot. 62:4943-4954(2011).
4