Stem-loop sequence osa-MIR2867

AccessionMI0013029 (change log)
DescriptionOryza sativa miR2867 stem-loop
Literature search

1 open access papers mention osa-MIR2867
(1 sentences)

Stem-loop
   caau                       a   c a  a        g   caa 
5'     ugacggcgugugccaucccacac ucc g uc uggcgugu aca   c
       ||||||||||||||||||||||| ||| | || |||||||| |||    
3'     acuguuguacacgguagggugug agg c ag accgugcg ugu   u
   ----                       c   a c  c        -   agg 
Get sequence
Deep sequencing
69 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 16277650-16277750 [+]
intergenic
Database links

Mature sequence osa-miR2867-5p

Accession MIMAT0013814
Previous IDsosa-miR2867
Sequence

13 - 

ugugccaucccacacaucccga

 - 34

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence osa-miR2867-3p

Accession MIMAT0020947
Sequence

72 - 

ccaggacgugugggauggca

 - 91

Get sequence
Deep sequencing66 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).
2