Stem-loop sequence osa-MIR2865

AccessionMI0013027 (change log)
DescriptionOryza sativa miR2865 stem-loop
Literature search

1 open access papers mention osa-MIR2865
(1 sentences)

Stem-loop
   ----   c   -      a      g                g        cc 
5'     gau uga auccuc gcaguc acuguaccgugccuuu ucauugau  a
       ||| ||| |||||| |||||| |||||||||||||||| ||||||||   
3'     cua acu uaggag cgucag ugacguggcacggaaa agugauug  c
   aggc   -   c      a      -                a        ua 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 8515693-8515793 [-]
intergenic
Database links

Mature sequence osa-miR2865

Accession MIMAT0013812
Sequence

11 - 

cucagcagucgacuguaccgug

 - 32

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).