Stem-loop sequence osa-MIR2864

AccessionMI0013026 (change log)
DescriptionOryza sativa miR2864 stem-loop
Literature search

3 open access papers mention osa-MIR2864
(6 sentences)

Stem-loop
   ucuauucag      c  c                 u     uagcaaua      uc 
5'          cuuuug ug ccuuguuuugcauugua aggua        ugccau  u
            |||||| || ||||||||||||||||| |||||        ||||||   
3'          gagaac ac ggaacaaaacgugacau uccau        acggug  g
   ---------      a  a                 c     --------      au 
Get sequence
Deep sequencing
32 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 25664721-25664821 [-]
intergenic
Database links

Mature sequence osa-miR2864.1

Accession MIMAT0013810
Sequence

11 - 

uuuugcugcccuuguuuugca

 - 31

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence osa-miR2864.2

Accession MIMAT0013811
Sequence

22 - 

uuguuuugcauuguauaggua

 - 42

Get sequence
Deep sequencing19 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).