Stem-loop sequence osa-MIR2863a

AccessionMI0013025 (change log)
DescriptionOryza sativa miR2863a stem-loop
Gene family MIPF0000925; MIR2863
Literature search

3 open access papers mention osa-MIR2863a
(3 sentences)

Stem-loop
   u            u                     g     cu  agggaguaaauucua 
5'  ggguacccauug cccauucuaguuuagcuaaau aacua  ac               u
    |||||||||||| ||||||||||||||||||||| |||||  ||                
3'  uccauggguaac ggguaagaucgaguugauuua uugau  ug               g
   -            u                     a     uu  agugaaaaggaccag 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 27108339-27108459 [+]
intergenic
Database links

Mature sequence osa-miR2863a

Accession MIMAT0013809
Sequence

11 - 

uugucccauucuaguuuagcu

 - 31

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).