Stem-loop sequence ola-mir-430c-7

AccessionMI0013023 (change log)
DescriptionOryzias latipes miR-430c-7 stem-loop
Gene family MIPF0000003; mir-430
Literature search

3 open access papers mention ola-mir-430c-7
(9 sentences)

Stem-loop
   -----------------------------------------a        guguuucu  u 
5'                                           aaagaaau        cc c
                                             ||||||||        || u
3'                                           uuucuuua        gg g
   aacgaucugugguucugaugggguuguacaucgugaaugacg        aguuccau  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ola-miR-430c

Accession MIMAT0013805
Sequence

47 - 

uaagugcuacauguugggguag

 - 68

Get sequence
Evidence experimental; in-situ [1], Northern [1]

References

1