Stem-loop sequence ola-mir-430c-6

AccessionMI0013022 (change log)
DescriptionOryzias latipes miR-430c-6 stem-loop
Gene family MIPF0000003; mir-430
Literature search

3 open access papers mention ola-mir-430c-6
(9 sentences)

Stem-loop
   aaaaaaauuuucaaacuuuuuccuu      -   nnnnnnnnnnaauuucuuugcag 
5'                          uugggc ccc                       u
                            |||||| |||                        
3'                          gaucug ggg                       a
   ----------------------aac      u   ucugaugggguuguacaucguga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ola-miR-430c

Accession MIMAT0013805
Sequence

58 - 

uaagugcuacauguugggguag

 - 79

Get sequence
Evidence experimental; in-situ [1], Northern [1]

References

1