Stem-loop sequence ola-mir-430b-2

AccessionMI0013021 (change log)
DescriptionOryzias latipes miR-430b-2 stem-loop
Gene family MIPF0000003; mir-430
Literature search

3 open access papers mention ola-mir-430b-2
(10 sentences)

Stem-loop
         a     g    ug   -ca      g   - uuuc 
5' ggacau aagau accu  aca   ggcacu acu c    u
   |||||| ||||| ||||  |||   |||||| ||| |     
3' cuugug uuuua uggg  ugu   ucguga uga g    u
         g     a    gu   aca      a   u uuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ola-miR-430b

Accession MIMAT0013806
Sequence

50 - 

uaagugcuacauguugggguaa

 - 71

Get sequence
Evidence experimental; in-situ [1], Northern [1]

References

1