Stem-loop sequence ola-mir-430d-3

Accession MI0013020
Description Oryzias latipes miR-430d-3 stem-loop
Gene family MIPF0000003; mir-430
Stem-loop 
      - uuc     c        c   ga    gau  uuu 
gaaucg c   gaggc aucucaaa aga  cacu   gg   u
|||||| |   ||||| |||||||| |||  ||||   ||   g
uuuggu g   cucug ugggguuu ucu  guga   cc   a
      u uaa     u        c   uc    -au  uuu
Get sequence
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
4: 2069008-2069094 [+]
sense
Clustered miRNAs
< 10kb from ola-mir-430d-3
ola-mir-430d-1 4: 2061569-2061655 [-]
ola-mir-430a-2 4: 2064352-2064433 [+]
ola-mir-430d-2 4: 2064788-2064874 [+]
ola-mir-430a-3 4: 2065212-2065293 [+]
ola-mir-430a-4 4: 2068492-2068573 [+]
ola-mir-430c-5 4: 2068709-2068796 [+]
ola-mir-430d-3 4: 2069008-2069094 [+]

Mature sequence ola-miR-430d

Accession MIMAT0013807
Sequence

51 -  

uaagugcuucucuuugggguug

 - 72

Get sequence
Evidence experimental; in-situ [1], Northern [1]

References

1
PMID:19770025 "Genomic organization and embryonic expression of miR-430 in medaka (Oryzias latipes): insights into the post-transcriptional gene regulation in early development" Tani S, Kusakabe R, Naruse K, Sakamoto H, Inoue K Gene. 449:41-49(2010).