Stem-loop sequence ola-mir-430c-5

AccessionMI0013019 (change log)
DescriptionOryzias latipes miR-430c-5 stem-loop
Gene family MIPF0000003; mir-430
Literature search

3 open access papers mention ola-mir-430c-5
(9 sentences)

Stem-loop
   guc      uc    g          -a      g   -    u 
5'    ggacau  agau accuuaacau  ggcacu acu ugaa u
      ||||||  |||| ||||||||||  |||||| ||| ||||  
3'    ucugug  ucug ugggguugua  ucguga uga guuu u
   uga      gu    a          ca      a   c    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
4: 2068709-2068796 [+]
sense
Clustered miRNAs
< 10kb from ola-mir-430c-5
ola-mir-430d-14: 2061569-2061655 [-]
ola-mir-430a-24: 2064352-2064433 [+]
ola-mir-430d-24: 2064788-2064874 [+]
ola-mir-430a-34: 2065212-2065293 [+]
ola-mir-430a-44: 2068492-2068573 [+]
ola-mir-430c-54: 2068709-2068796 [+]
ola-mir-430d-34: 2069008-2069094 [+]
Database links

Mature sequence ola-miR-430c

Accession MIMAT0013805
Sequence

53 - 

uaagugcuacauguugggguag

 - 74

Get sequence
Evidence experimental; in-situ [1], Northern [1]

References

1