Stem-loop sequence ola-mir-430a-4

AccessionMI0013018 (change log)
DescriptionOryzias latipes miR-430a-4 stem-loop
Gene family MIPF0000003; mir-430
Literature search

3 open access papers mention ola-mir-430a-4
(9 sentences)

Stem-loop
               g    ug   -ca      g   - uuuc 
5' ggacaucaagau accu  aca   ggcacu acu c    u
   |||||||||||| ||||  |||   |||||| ||| |     
3' ccugugguuuua uggg  ugu   ucguga uga g    u
               a    gu   uca      a   u uuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
4: 2068492-2068573 [+]
sense
ENSORLT00000026203 ; ola-mir-430a-3-201; exon 1
Clustered miRNAs
< 10kb from ola-mir-430a-4
ola-mir-430d-14: 2061569-2061655 [-]
ola-mir-430a-24: 2064352-2064433 [+]
ola-mir-430d-24: 2064788-2064874 [+]
ola-mir-430a-34: 2065212-2065293 [+]
ola-mir-430a-44: 2068492-2068573 [+]
ola-mir-430c-54: 2068709-2068796 [+]
ola-mir-430d-34: 2069008-2069094 [+]
Database links

Mature sequence ola-miR-430a

Accession MIMAT0013804
Sequence

50 - 

uaagugcuacuuguuggggua

 - 70

Get sequence
Evidence experimental; in-situ [1], Northern [1]

References

1