Stem-loop sequence ola-mir-430c-4

AccessionMI0013015 (change log)
DescriptionOryzias latipes miR-430c-4 stem-loop
Gene family MIPF0000003; mir-430
Literature search

3 open access papers mention ola-mir-430c-4
(9 sentences)

Stem-loop
   ccuuuc    -     uuuccu   caaa  aua      cnnnnnnnnnnucuu  c   a 
5'       uuag cacua      gac    ac   ccaaca               ug agu a
         |||| |||||      |||    ||   ||||||               || |||  
3'       gauc guggu      cug    ug   gguugu               ac ucg g
   ---aac    u     -----u   ---a  --g      ---------------  a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ola-miR-430c

Accession MIMAT0013805
Sequence

60 - 

uaagugcuacauguugggguag

 - 81

Get sequence
Evidence experimental; in-situ [1], Northern [1]

References

1