Stem-loop sequence ola-mir-430d-1

AccessionMI0013013 (change log)
DescriptionOryzias latipes miR-430d-1 stem-loop
Gene family MIPF0000003; mir-430
Literature search

3 open access papers mention ola-mir-430d-1
(10 sentences)

Stem-loop
         - uuc     c        c   ga    gau  uuu 
5' gaaucg c   gagac aucucaaa aga  cacu   gg   u
   |||||| |   ||||| |||||||| |||  ||||   ||   g
3' uuuggu g   cucug ugggguuu ucu  guga   cc   a
         u uaa     u        c   uc    -au  uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
4: 2061569-2061655 [-]
sense
ENSORLT00000026051 ; ola-mir-430d-1-201; exon 1
Clustered miRNAs
< 10kb from ola-mir-430d-1
ola-mir-430d-34: 2069008-2069094 [+]
ola-mir-430c-54: 2068709-2068796 [+]
ola-mir-430a-44: 2068492-2068573 [+]
ola-mir-430a-34: 2065212-2065293 [+]
ola-mir-430d-24: 2064788-2064874 [+]
ola-mir-430a-24: 2064352-2064433 [+]
ola-mir-430d-14: 2061569-2061655 [-]
Database links

Mature sequence ola-miR-430d

Accession MIMAT0013807
Sequence

51 - 

uaagugcuucucuuugggguug

 - 72

Get sequence
Evidence experimental; in-situ [1], Northern [1]

References

1