Stem-loop sequence ola-mir-430b-1

AccessionMI0013010 (change log)
DescriptionOryzias latipes miR-430b-1 stem-loop
Gene family MIPF0000003; mir-430
Literature search

3 open access papers mention ola-mir-430b-1
(10 sentences)

Stem-loop
         a     g    ug   -ca      g   uuuuc 
5' ggacau aagau accu  aca   ggcacu acu     u
   |||||| ||||| ||||  |||   |||||| |||     u
3' ccugug uuuua uggg  ugu   ucguga uga     c
         g     a    gu   aca      a   uguuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
4: 7977-8058 [+]
intergenic
Clustered miRNAs
< 10kb from ola-mir-430b-1
ola-mir-430a-14: 6743-6824 [+]
ola-mir-430c-14: 6962-7047 [+]
ola-mir-430b-14: 7977-8058 [+]
ola-mir-430c-24: 8194-8281 [+]
ola-mir-430c-34: 13010-13098 [+]
Database links

Mature sequence ola-miR-430b

Accession MIMAT0013806
Sequence

50 - 

uaagugcuacauguugggguaa

 - 71

Get sequence
Evidence experimental; in-situ [1], Northern [1]

References

1