Stem-loop sequence ola-mir-430c-1

AccessionMI0013009 (change log)
DescriptionOryzias latipes miR-430c-1 stem-loop
Gene family MIPF0000003; mir-430
Literature search

3 open access papers mention ola-mir-430c-1
(9 sentences)

Stem-loop
   --c      uc    g          -a      g   -    u 
5'    agacau  agau accuuaacau  ggcacu acu ugaa a
      ||||||  |||| ||||||||||  |||||| ||| ||||  
3'    ucugug  ucug ugggguugua  ucguga uga guuu u
   cga      gu    a          ca      a   c    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
4: 6962-7047 [+]
sense
Clustered miRNAs
< 10kb from ola-mir-430c-1
ola-mir-430a-14: 6743-6824 [+]
ola-mir-430c-14: 6962-7047 [+]
ola-mir-430b-14: 7977-8058 [+]
ola-mir-430c-24: 8194-8281 [+]
ola-mir-430c-34: 13010-13098 [+]
Database links

Mature sequence ola-miR-430c

Accession MIMAT0013805
Sequence

51 - 

uaagugcuacauguugggguag

 - 72

Get sequence
Evidence experimental; in-situ [1], Northern [1]

References

1