Stem-loop sequence ola-mir-430a-1

AccessionMI0013008 (change log)
DescriptionOryzias latipes miR-430a-1 stem-loop
Gene family MIPF0000003; mir-430
Literature search

3 open access papers mention ola-mir-430a-1
(9 sentences)

Stem-loop
         -       a   ug   -ca      g   - uuuc 
5' ggacau aaagaug ccu  aca   ggcacu acu c    u
   |||||| ||||||| |||  |||   |||||| ||| |     
3' ccugug uuuuuau ggg  ugu   ucguga uga g    u
         g       -   gu   uca      a   u uuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
4: 6743-6824 [+]
sense
ENSORLT00000026191 ; ola-mir-430a-1-201; exon 1
Clustered miRNAs
< 10kb from ola-mir-430a-1
ola-mir-430a-14: 6743-6824 [+]
ola-mir-430c-14: 6962-7047 [+]
ola-mir-430b-14: 7977-8058 [+]
ola-mir-430c-24: 8194-8281 [+]
ola-mir-430c-34: 13010-13098 [+]
Database links

Mature sequence ola-miR-430a

Accession MIMAT0013804
Sequence

50 - 

uaagugcuacuuguuggggua

 - 70

Get sequence
Evidence experimental; in-situ [1], Northern [1]

References

1