Stem-loop sequence bmo-mir-2857

AccessionMI0013000 (change log)
DescriptionBombyx mori miR-2857 stem-loop
Stem-loop
   -       a  u a      -  a     aa  u   ggag 
5'  cuguaug cc g ugggac ac uacgg  ca gcu    c
    ||||||| || | |||||| || |||||  || |||    u
3'  gacauac gg c acucug ug gugcu  gu cga    a
   g       a  u -      c  -     -a  -   agaa 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581355.1: 2224-2302 [+]
intergenic
NW_004622220.1: 426-504 [+]
intergenic
Database links

Mature sequence bmo-miR-2857

Accession MIMAT0013796
Sequence

11 - 

ugaugggacacauacggaacau

 - 32

Get sequence
Deep sequencing9 reads, 3 experiments
Evidence not experimental

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).