Stem-loop sequence bmo-mir-2855

AccessionMI0012996 (change log)
DescriptionBombyx mori miR-2855 stem-loop
Stem-loop
   uguu  -     gg   -acu   ca   cu    g  c 
5'     gu gugac  gua    uug  ucg  ggca ug a
       || |||||  |||    |||  |||  |||| ||  
3'     ca cacug  cgu    aac  agc  ccgu ac a
   ---g  g     -a   cucu   -c   -u    a  g 
Get sequence
Deep sequencing
32 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581739.1: 143376-143447 [-]
intergenic
Database links

Mature sequence bmo-miR-2855

Accession MIMAT0013790
Sequence

11 - 

cggguaacuuugcaucgcuggca

 - 33

Get sequence
Deep sequencing30 reads, 3 experiments
Evidence not experimental
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).