Stem-loop sequence bmo-mir-2854

AccessionMI0012995 (change log)
DescriptionBombyx mori miR-2854 stem-loop
Literature search

1 open access papers mention bmo-mir-2854
(1 sentences)

Stem-loop
   -     -    ----uu  uuca      c    c    uuu 
5'  aagcc cuuu      cu    aaacug agga ggcc   a
    ||||| ||||      ||    |||||| |||| ||||   u
3'  uuugg gaag      ga    uuugac uuuu ccgg   a
   c     u    uaaauc  cgca      c    -    ugc 
Get sequence
Deep sequencing
328 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581840.1: 40728-40807 [-]
intergenic
Database links

Mature sequence bmo-miR-2854

Accession MIMAT0013789
Sequence

11 - 

ucuuucaaaacugcaggacgg

 - 31

Get sequence
Deep sequencing325 reads, 3 experiments
Evidence not experimental
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).