Stem-loop sequence bmo-mir-1b

Accession MI0012994
Previous IDs bmo-mir-1-as
Description Bombyx mori miR-1b stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-cc     - c   aua         a       ugauu 
   gcgca g ucc   cuucuuuac uuccaua     a
   ||||| | |||   ||||||||| |||||||     c
   cgcgu c agg   gaaggaaug aggguau     a
gaa     u a   cac         a       cagua 
Get sequence
Deep sequencing
102 reads, 3 experiments
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2589: 5616178-5616256 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-1b
bmo-mir-1a nscaf2589: 5616175-5616259 [-]
bmo-mir-1b nscaf2589: 5616178-5616256 [+]

Mature sequence bmo-miR-1b-5p

Accession MIMAT0013787
Previous IDs bmo-miR-1-as*;bmo-miR-1b*
Sequence

11 - 

ccauacuucuuuacauuccaua

 - 32

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1]

Mature sequence bmo-miR-1b-3p

Accession MIMAT0013788
Previous IDs bmo-miR-1-as;bmo-miR-1
Sequence

48 - 

ugggaaguaaggaagcacggaa

 - 69

Get sequence
Deep sequencing 101 reads, 3 experiments
Evidence experimental; Solexa [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).