Stem-loop sequence bmo-mir-1b

AccessionMI0012994 (change log)
Previous IDsbmo-mir-1-as
DescriptionBombyx mori miR-1b stem-loop
Gene family MIPF0000038; mir-1
Literature search

12 open access papers mention bmo-mir-1b
(52 sentences)

Stem-loop
   -cc     - c   aua         a       ugauu 
5'    gcgca g ucc   cuucuuuac uuccaua     a
      ||||| | |||   ||||||||| |||||||     c
3'    cgcgu c agg   gaaggaaug aggguau     a
   gaa     u a   cac         a       cagua 
Get sequence
Deep sequencing
120 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582020.1: 5628058-5628136 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-1b
bmo-mir-1aNW_004582020.1: 5628055-5628139 [-]
bmo-mir-1bNW_004582020.1: 5628058-5628136 [+]
Database links

Mature sequence bmo-miR-1b-5p

Accession MIMAT0013787
Previous IDsbmo-miR-1-as*;bmo-miR-1b*
Sequence

11 - 

ccauacuucuuuacauuccaua

 - 32

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence bmo-miR-1b-3p

Accession MIMAT0013788
Previous IDsbmo-miR-1-as;bmo-miR-1
Sequence

48 - 

ugggaaguaaggaagcacggaa

 - 69

Get sequence
Deep sequencing113 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).