Stem-loop sequence bmo-mir-2852

AccessionMI0012992 (change log)
DescriptionBombyx mori miR-2852 stem-loop
Stem-loop
   -        ----a -    --u   gg    u     uaaau    g 
5'  agcauaga     c caga   uuc  auuu uugua     ugcu u
    ||||||||     | ||||   |||  |||| |||||     |||| a
3'  ucguaucu     g guuu   aag  uaga aacau     gcga u
   a        gccaa a    uuu   --    c     caagu    g 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582013.1: 5979989-5980077 [-]
intergenic
Database links

Mature sequence bmo-miR-2852

Accession MIMAT0013785
Sequence

11 - 

cagauuucggauuuuuugua

 - 30

Get sequence
Deep sequencing11 reads, 2 experiments
Evidence not experimental

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).